Cell Signaling T3 RNA Polymerase Product T3 RNA Polymerase T3 RNA Polymerase (HC) For Laboratory Use. Size Conc. Cat.# Price (Fr) 1,000 u 10–20 u/µl P2083 122.00 2,500 u 80 u/µl P4024 229.00 Description: T3 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only T3 DNA or DNA cloned downstream from a T3 promoter can serve as a template for T3 RNA Polymerase-directed RNA synthesis. Features: • Specific: T3 RNA Polymerase exhibits extremely high affinity and specificity for T3 promoter sequences. • Highly Pure: T3 RNA Polymerase is >90% pure as determined by SDS polyacrylamide gel electrophoresis. Free of detectable levels of contaminating RNase and DNase activity (<1% release). • Flexible: Will incorporate 32P, 33P, 3H and 35S nucleoside triphosphates. • Provided with 5X Reaction Buffer: Provided with 100mM DTT and Transcription Optimized 5X Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2, 10mM spermidine, 50mM NaCl. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/myway/ Storage Conditions: Store at –20°C. Protocol T3 RNA Polymerase Protocol T7 RNA Polymerase Product T7 RNA Polymerase T7 RNA Polymerase (HC) For Laboratory Use. Size Conc. Cat.# Price (Fr) 1,000 u 10–20 u/µl P2075 122.00 5,000 u 10–20 u/µl P2077 473.00 10,000 u 80 u/µl P4074 710.00 Description: T7 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only T7 DNA or DNA cloned downstream from a T7 promoter can serve as a template for T7 RNA Polymerase-directed RNA synthesis. Features: • Specific: T7 RNA Polymerase exhibits extremely high affinity and specificity for T7 promoter sequences. • Highly Pure: T7 RNA Polymerase is judged to be greater than 90% pure as determined by SDS polyacrylamide gel electrophoresis. Free of detectable levels of contaminating RNase and DNase activity (<1% release). • Flexible: Will incorporate 32P, 33P, 3H and 35S nucleoside triphosphates. • Provided with 5X Reaction Buffer: Provided with 100mM DTT and Transcription Optimized 5X Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2, 10mM spermidine, 50mM NaCl. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/myway/ Storage Conditions: Store at –20°C. Protocol T7 RNA Polymerase Protocol Part# 9PIP207 Part# 9PIP208 RNA Polymerase Promoter Sequencing Primers Product SP6 Promoter Primer T7 Promoter Primer T7 EEV Promoter Primer Size Conc. Cat.# Price (Fr) 2 µg 10 µg/ml Q5011 156.00 2 µg 10 µg/ml Q5021 156.00 2 µg 10 µg/ml Q6700 135.00 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SP6 and T7 Promoter Primers are designed for sequencing inserts cloned into the pGEM® Vectors. The SP6 Promoter Primer is designed for sequencing inserts cloned into the pALTER®-MAX and pCI-neo Vectors. The primers are designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA. The promoter primers are purified by gel electrophoresis or HPLC. The T7 EEV Promoter Primer is suitable for sequencing the pALTER®-MAX, pCMVTNT™, pTNT™ and phMGFP Vectors, and the pCI/pSI series of mammalian expression vectors. Primer Sequences • SP6: 5´-d(TATTTAGGTGACACTATAG)-3´ • T7: 5´-d(TAATACGACTCACTATAGGG)-3´ • T7 EEV: 5´-d(AAGGCTAGAGTACTTAATACGA)-3´ Storage Conditions: Store at –20°C. 4 For complete and up-to-date product information visit: www.promega.com/catalog 91 Cloning and DNA Markers Pagina 94
Pagina 96Heeft u een reisgids, onlinemag of e-PDF's? Gebruik Online Touch: uitgave online zetten.
Promega Switzerland - Life Sciences Catalog 2012 Lees publicatie 100Home