Science Catalog 2012 Life Cell Signaling Reporter Vector and Luciferase Sequencing Primers Product RVprimer3 (clockwise) RVprimer4 (counterclockwise) GLprimer1 (clockwise) GLprimer2 (counterclockwise) For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc™ Vectors and pCAT®3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used to sequence double-stranded templates, but only RVprimer4 can be used to sequence single-stranded templates. Reporter Vector Sequencing Primer Information. GLprimer2 Sequences from luc ORF into multiple cloning region. Will pGL3 Vectors pCAT®3 Vectors Chroma-Luc™ (Click Beetle) Vectors (pCBR, pCBG68, pCBG99) pGL4 Vectors 9490LA RVprimer3 5′ . . . CTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATA SV40 Promoter GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGCGATCTAAGTAAGCTTGG . . . KpnI SacI Acc65I MluI NheI XmaI SmaI XhoI BglII luc+ Coding Region Start NcoI GLprimer2 HindIII SV40 Enhancer CATTCCGGTACTGTTGGTAAAGCCACCATGGAAGACGCCAAAAACATAAAG . . . (1892bp) . . . GGATCCGTCGAC BamHI SalI RVprimer3 Sequences from upstream of multiple cloning region into sequence through SV40 promoter multiple cloning region. if present. RVprimer4 Sequences from downstream of reporter ORF and poly adenylation sequences into SalI, BamHI multiple cloning region, which is intended for cloning enhancer elements. Size Cat.# Price (Fr) 2 µg E4481 166.00 2 µg E4491 166.00 2 µg E1651 169.00 2 µg E1661 169.00 The GLprimer1 sequences clockwise across the cloning sites upstream of the luciferase gene in the pGL2 Vectors. GLprimer2 sequences counterclockwise across the cloning sites upstream of the luciferase gene in pGL2 or pGL3 Vectors. Both GLprimers can be used to sequence double-stranded DNA, but only the GLprimer2 can be used to sequence single-stranded DNA. Primer Sequences • GLprimer1: 5´-d(TGTATCTTATGGTACTGTAACTG)-3´ • GLprimer2: 5´-d(CTTTATGTTTTTGGCGTCTTCCA)-3´ • RVprimer3: 5´-d(CTAGCAAAATAGGCTGTCCC)-3´ • RVprimer4: 5´-d(GACGATAGTCATGCCCCGCG)-3´ Storage Conditions: Store at –20°C. The primers are supplied dried. CGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTC . . . 3′ RVprimer4 pGL3 Vector multiple cloning region. The upstream and downstream cloning sites and the locations of the sequencing primers, RVprimer3, GLprimer2 and RVprimer4, are shown. The arrows above the primers indicate the direction of sequencing. The positions of the promoter (in pGL3-Promoter and pGL3-Control) and the enhancer (in pGL3-Enhancer and pGL3-Control) are shown as insertions into the sequence of pGL3-Basic (note that the promoter replaces four bases of pGL3-Basic). The sequence shown is of the ssDNA produced using the f1 origin. 278 For complete and up-to-date product information visit: www.promega.com/catalog 0756MA08_4A Pagina 281

Pagina 283

Scoor meer met een webwinkel in uw brochures. Velen gingen u voor en publiceerden onderzoeksrapporten online.

Promega Switzerland - Life Sciences Catalog 2012 Lees publicatie 100Home


You need flash player to view this online publication